|
Kuang Lung Shing
library of single guide rnas (sgrnas) Library Of Single Guide Rnas (Sgrnas), supplied by Kuang Lung Shing, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/library of single guide rnas (sgrnas)/product/Kuang Lung Shing Average 90 stars, based on 1 article reviews
library of single guide rnas (sgrnas) - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Synthego Inc
single guide rnas (sgrnas) sulf1 Single Guide Rnas (Sgrnas) Sulf1, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/single guide rnas (sgrnas) sulf1/product/Synthego Inc Average 90 stars, based on 1 article reviews
single guide rnas (sgrnas) sulf1 - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Synthego Inc
sgrna pool of 3 guide rnas for mouse yb1 ![]() Sgrna Pool Of 3 Guide Rnas For Mouse Yb1, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/sgrna pool of 3 guide rnas for mouse yb1/product/Synthego Inc Average 90 stars, based on 1 article reviews
sgrna pool of 3 guide rnas for mouse yb1 - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
GenScript corporation
csf1 cytokine ![]() Csf1 Cytokine, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/csf1 cytokine/product/GenScript corporation Average 90 stars, based on 1 article reviews
csf1 cytokine - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Beijing Genomics Institute Shenzhen
primers for four single guide rnas (sgrnas) ![]() Primers For Four Single Guide Rnas (Sgrnas), supplied by Beijing Genomics Institute Shenzhen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primers for four single guide rnas (sgrnas)/product/Beijing Genomics Institute Shenzhen Average 90 stars, based on 1 article reviews
primers for four single guide rnas (sgrnas) - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Applied Biological Materials Inc
single guiding rna ![]() Single Guiding Rna, supplied by Applied Biological Materials Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/single guiding rna/product/Applied Biological Materials Inc Average 90 stars, based on 1 article reviews
single guiding rna - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Synthego Inc
single guide rnas (sgrnas) targeting cd1d gene (gcuuuaccucccgguuuaag ![]() Single Guide Rnas (Sgrnas) Targeting Cd1d Gene (Gcuuuaccucccgguuuaag, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/single guide rnas (sgrnas) targeting cd1d gene (gcuuuaccucccgguuuaag/product/Synthego Inc Average 90 stars, based on 1 article reviews
single guide rnas (sgrnas) targeting cd1d gene (gcuuuaccucccgguuuaag - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Synthego Inc
chemically modified single guide rnas (sgrnas) targeting human egln1 ![]() Chemically Modified Single Guide Rnas (Sgrnas) Targeting Human Egln1, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/chemically modified single guide rnas (sgrnas) targeting human egln1/product/Synthego Inc Average 90 stars, based on 1 article reviews
chemically modified single guide rnas (sgrnas) targeting human egln1 - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Vigene Biosciences
single guide rnas (sgrnas) ![]() Single Guide Rnas (Sgrnas), supplied by Vigene Biosciences, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/single guide rnas (sgrnas)/product/Vigene Biosciences Average 90 stars, based on 1 article reviews
single guide rnas (sgrnas) - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
ToolGen Incorporated
y105c5a.1272 targeting single-guide rnas (sgrnas) ![]() Y105c5a.1272 Targeting Single Guide Rnas (Sgrnas), supplied by ToolGen Incorporated, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/y105c5a.1272 targeting single-guide rnas (sgrnas)/product/ToolGen Incorporated Average 90 stars, based on 1 article reviews
y105c5a.1272 targeting single-guide rnas (sgrnas) - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
GenScript corporation
genome-wide lentiviral human crispr knockout guide library with 58 028 single-guide rnas (sgrnas) ![]() Genome Wide Lentiviral Human Crispr Knockout Guide Library With 58 028 Single Guide Rnas (Sgrnas), supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/genome-wide lentiviral human crispr knockout guide library with 58 028 single-guide rnas (sgrnas)/product/GenScript corporation Average 90 stars, based on 1 article reviews
genome-wide lentiviral human crispr knockout guide library with 58 028 single-guide rnas (sgrnas) - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Benchling Inc
sequence of kras exon 2 ![]() Sequence Of Kras Exon 2, supplied by Benchling Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/sequence of kras exon 2/product/Benchling Inc Average 90 stars, based on 1 article reviews
sequence of kras exon 2 - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Cancers
Article Title: YB1 Is a Major Contributor to Health Disparities in Triple Negative Breast Cancer
doi: 10.3390/cancers13246262
Figure Lengend Snippet: ( A ) Quantification of Yb1 mRNA expression levels based on log2 RSEM values batch normalized from Illumina HiSeq RNASeq data by breast cancer subtype in the breast cancer BRCA patient data from TCGA PanCancer Atlas. Expression levels of YB1 are significantly higher (*** p < 0.0001, Wilcoxon) in the basal (TNBC) subtype when compared to other BC subtypes. ( B ) Survival analysis based on YB1 expression levels (median values) in the basal subtype of the TCGA BRCA PanCancer Atlas cohort. YB1 activation in TNBCs is associated with poorer overall survival ( p = 0.049). ( C ) KM plot correlating survival of 4929 BC patients with YB1 mRNA expression levels. High YB1 expression levels correlate with poor survival probability in BC patients ( p < 1.9 × 10 −8 ). ( D ) KM plot correlating the survival of BC patients with YB1 protein expression levels. High YB1 expression levels correlate with poor survival probability in BC patients ( p = 0.047). ( E ) KM plot correlating the survival of TNBC patients with YB1 mRNA expression levels. High YB1 expression levels correlate with poor survival probability in TNBC patients ( p = 0.03).
Article Snippet: The sgRNA pool of 3 guide RNAs for
Techniques: Expressing, Activation Assay
Journal: Cancers
Article Title: YB1 Is a Major Contributor to Health Disparities in Triple Negative Breast Cancer
doi: 10.3390/cancers13246262
Figure Lengend Snippet: ( A ) YB1 mRNA transcript quantification in AA and CA TNBC cell lines was determined by qt-RT-PCR and data was plotted as the fold change in HCC1806. ( B ) Average YB1 mRNA transcripts in AA and CA TNBC cell lines was plotted as the fold change in AA cell lines. YB1 transcript expression levels are significantly higher (* p < 0.001, Student ’ t test) in AA TNBC cell lines when compared to their CA counterparts. ( C ) Comparison of YB1 expression levels, levels based on log2 RSEM values batch normalized from Illumina HiSeq RNASeq data, between AA and CA BC patients from the TCGA BRCA PanCancer Atlas cohort. YB1 expression levels are significantly higher (* p < 0.01, Wilcoxon) in AA when compared to CA BC tumors. ( D ) Comparison of YB1 expression levels between CA and AA TNBC from the MetroHealth TNBC cohort, as determined by qt-RT-PCR. Data was plotted as the fold change to AA tumors. YB1 expression levels are significantly higher (* p < 0.01, Student ’ t test) in AA when compared to CA BC tumors.
Article Snippet: The sgRNA pool of 3 guide RNAs for
Techniques: Reverse Transcription Polymerase Chain Reaction, Expressing, Comparison
Journal: Cancers
Article Title: YB1 Is a Major Contributor to Health Disparities in Triple Negative Breast Cancer
doi: 10.3390/cancers13246262
Figure Lengend Snippet: ( A ) Western Blot analysis of protein lysates from parental (Ctrl) AA (black font) and CA (red font) TNBC cell lines and their YB1-KO derivatives, that were probed with the indicated antibodies. β-Actin was used a loading control. ( B , C ) Colony formation assay. The numbers under the bands represent the fold change of the Western Blot signal normalized to that of the parental cell line, as determined by densitometry analyses from one representative of 3 replicate blots. ( B ) Representative images of colony formation of parental and YB1-KO AA (black font) and CA (red font) TNBC cell lines. ( C ) Quantification of the number of colonies in each plate. Data is plotted as the percentage change from the control cells. Data shown are representative of 3 replicates (***, p < 0.0001, Student ’ t test).
Article Snippet: The sgRNA pool of 3 guide RNAs for
Techniques: Western Blot, Control, Colony Assay
Journal: Cancers
Article Title: YB1 Is a Major Contributor to Health Disparities in Triple Negative Breast Cancer
doi: 10.3390/cancers13246262
Figure Lengend Snippet: ( A ) Incidence (top) and latency (bottom) of tumor growth of prenatal 4T1 or its YB1-KO derivative cells that were inoculated in the mammary fat pads of female Balb/C mice ( n = 5 mice per group). ( B ) Quantification of tumor volume of tumors generated from the inoculation of control 4T1 cells or their YB1-KO derivatives into the mammary fat pads of female Balb/C mice. ( C , top panel ) Quantification of lung metastasis nodules from the animal experiment described in ( B ). The bottom panel shows representative lungs from each mouse group. ( D ) Quantification of the tumor volume of tumors generated from the inoculation of control MDA-MB-231 (grey graph), MDA-MB-468 (black graph) cells or their respective YB1-KO derivatives (yellow and red graphs, respectively) into the mammary fat pads of female NSG mice (n = 5 mice per group). ( E , F ) Quantification of lung metastasis nodules from the MDA-MB-468 ( E ) and the MDA-MB-231 animal experiment described in ( D ) (**, p < 0.001, Student ’ t -test).
Article Snippet: The sgRNA pool of 3 guide RNAs for
Techniques: Generated, Control
Journal: Cancers
Article Title: YB1 Is a Major Contributor to Health Disparities in Triple Negative Breast Cancer
doi: 10.3390/cancers13246262
Figure Lengend Snippet: ( A – E ) Comparisons of the IC50 values of cisplatin ( A , B ), doxorubicin ( C , D ) and docetaxel ( E , F ) between AA (black bars) and CA (red bars) TNBC cell lines. The IC50 values were derived from the CCLE database. Average IC50 in the AA and CA TNBC cell lines was plotted as fold change to AA cell lines for cisplatin ( B ), doxorubicin ( D ) and docetaxel ( F ), (*, p < 0.01, Fisher’s Exact). ( G ) Gene set enrichment analysis of the TCGA BRCA PanCancer Atlas dataset shows that the gene signature associated with docetaxel resistance is enriched in the BC tumors that express high levels of YB1. ( H ) Western Blots with the indicated antibodies of protein lysates from parental MDA-MB-MB-468 cells or those that were treated with doxorubicin for 48 h (transient treatment), or MDA-MB-468 cells that were generated to be permanently resistant (chronic) to doxorubicin (468-Dox-res). The numbers under the bands represent the fold change of the Western Blot signal normalized to that of the parental cell line. ( I ) Western Blots with the indicated antibodies of protein lysates from parental MDA-MB-468, their cisplatin resistant (Cis-R) or doxorubicin (Dox-R) derivatives. β-Actin was used as a loading control. The numbers under the bands represent the fold change of the Western Blot signal normalized to that of the parental cell line. ( J ) Quantification of the tumor volume of tumors generated from the inoculation of parental MDA-MB-468 cells (black graph), or their cisplatin resistant (Cis-R) derivatives into the mammary fat pads of female NSG mice (n = 5 mice per group). Treatment with cisplatin started 21 days post inoculation. (***, p < 0.0001, Student ’ t test).
Article Snippet: The sgRNA pool of 3 guide RNAs for
Techniques: Derivative Assay, Western Blot, Generated, Control
Journal: Molecular oral microbiology
Article Title: Interleukin-34 permits Porphyromonas gingivalis survival and NF- κ B p65 inhibition in macrophages
doi: 10.1111/omi.12366
Figure Lengend Snippet: Interleukin-34 (IL-34) and colony-stimulating factor 1 (CSF1) equally differentiate blood monocytes into macrophages. Flow cytometry analysis of (a) CD14 and (b) CD163 on undifferentiated monocytes as well as CSF1 and IL-34 differentiated macrophages. The mean fluorescence intensity (MFI) of CD14 is not significantly different between all three cell types, while CD163 expression is increased significantly upon differentiation of macrophages in the presence of both IL-34 and CSF1. In all cases, ≥ 95% of differentiated macrophages were positive for CD14 and CD163. Shown is the average ± standard error of 4–9 independent experiments, * indicates p < 0.05 by one-way ANOVA with Dunnett’s multiple comparison
Article Snippet: Macrophages were generated from blood monocytes in six-well culture plates in culture medium (Roswell Park Memorial Institute (RPMI)) 1640 medium [Corning] containing 10% Fetal Bovine Serum (FBS) (Caisson Labs), 100 IU/ml penicillin, 100 μ g/ml streptomycin, and 0.25 μ g/ml amphotericin) for 6 days supplemented with 50 ng/ml
Techniques: Flow Cytometry, Fluorescence, Expressing, Comparison
Journal: Molecular oral microbiology
Article Title: Interleukin-34 permits Porphyromonas gingivalis survival and NF- κ B p65 inhibition in macrophages
doi: 10.1111/omi.12366
Figure Lengend Snippet: IL-34 macrophages are less efficient at killing internalized Porphyromonas gingivalis. (a) CSF1 and IL-34 macrophages are equally efficient at internalizing P. gingivalis. Shown are the average (± standard error) internalized bacteria per macrophage after 30 min co-incubation (MOI 10:1) of four independent experiments with bacteria quantified within a minimum of 100 macrophages per experiment. (b) Percent survival of internalized P. gingivalis within macrophages for 60 or 120 min post-uptake using an antibiotic protection assay. Shown is the mean (± standard error) of 3–4 independent experiments, p-value calculated with (a) an unpaired t-test and (b) a two-way ANOVA followed by Šídák’s multiple comparison test of survival of P. gingivalis within IL-34 and CSF1-differentiated macrophages at each timepoint
Article Snippet: Macrophages were generated from blood monocytes in six-well culture plates in culture medium (Roswell Park Memorial Institute (RPMI)) 1640 medium [Corning] containing 10% Fetal Bovine Serum (FBS) (Caisson Labs), 100 IU/ml penicillin, 100 μ g/ml streptomycin, and 0.25 μ g/ml amphotericin) for 6 days supplemented with 50 ng/ml
Techniques: Bacteria, Incubation, Comparison
Journal: Molecular oral microbiology
Article Title: Interleukin-34 permits Porphyromonas gingivalis survival and NF- κ B p65 inhibition in macrophages
doi: 10.1111/omi.12366
Figure Lengend Snippet: IL-34 downregulates intracellular reactive oxygen species (ROS) production from macrophages. Luminol-based ROS detection was used to quantify the ROS response by CSF1- and IL-34-differentiated macrophages during the activation with phorbol myristate acetate (100 nm). (a) Representative panel for the time course of luminol luminescence detection, shown in relative luminescence units (RLU). (b) Mean peak RLU (with standard error) was detected over three independent experiments. * p < 0.01 (paired t-test)
Article Snippet: Macrophages were generated from blood monocytes in six-well culture plates in culture medium (Roswell Park Memorial Institute (RPMI)) 1640 medium [Corning] containing 10% Fetal Bovine Serum (FBS) (Caisson Labs), 100 IU/ml penicillin, 100 μ g/ml streptomycin, and 0.25 μ g/ml amphotericin) for 6 days supplemented with 50 ng/ml
Techniques: Activation Assay
Journal: Molecular oral microbiology
Article Title: Interleukin-34 permits Porphyromonas gingivalis survival and NF- κ B p65 inhibition in macrophages
doi: 10.1111/omi.12366
Figure Lengend Snippet: Comparison of the surface expression of markers with known P. gingivalis interactions on IL-34 and CSF1 macrophages. The majority of markers with known interactions with P. gingivalis are not significantly different between CSF1- and IL-34-differentiated macrophages, with the exception of dendritic cell-specific intercellular adhesion molecule-grabbing nonintegrin (DC-SIGN). Macrophages matured in the presence of either CSF1 or IL-34 were labeled with CD14 and one or more of C5aR, CD11b, TLR 2, TLR 4, or DC-SIGN and analyzed by flow cytometry. The cells were gated for positive CD14 (≥ 90% of differentiated cells), and the MFI of the additional markers was determined. Representative histograms are shown, along with the mean (± standard error) of at least four independent experiments per marker tested. p-values were determined by paired (IL-34 vs. CSF1) t-tests.
Article Snippet: Macrophages were generated from blood monocytes in six-well culture plates in culture medium (Roswell Park Memorial Institute (RPMI)) 1640 medium [Corning] containing 10% Fetal Bovine Serum (FBS) (Caisson Labs), 100 IU/ml penicillin, 100 μ g/ml streptomycin, and 0.25 μ g/ml amphotericin) for 6 days supplemented with 50 ng/ml
Techniques: Comparison, Expressing, Labeling, Flow Cytometry, Marker
Journal: Molecular oral microbiology
Article Title: Interleukin-34 permits Porphyromonas gingivalis survival and NF- κ B p65 inhibition in macrophages
doi: 10.1111/omi.12366
Figure Lengend Snippet: IL-34-matured macrophages produce less IL-8 than CSF1-matured macrophages. IL-34- or CSF1-differentiated macrophages were co-incubated with P. gingivalis for 24 h, with media samples removed at 2, 6, and 24 h and subsequently analyzed by multiplex ELISA. The analytes that had significant release above control macrophages are shown. Four independent experiments were performed, mean ± standard error is shown. p-values were determined by two-way ANOVA followed by Šídák’s multiple comparison test of IL-34 versus CSF1-differentiated macrophages at each timepoint: those without p-value indicated have a p > 0.05. Significantly less IL-8 was produced by IL-34-differentiated macrophages than by CSF1-differentiated macrophages
Article Snippet: Macrophages were generated from blood monocytes in six-well culture plates in culture medium (Roswell Park Memorial Institute (RPMI)) 1640 medium [Corning] containing 10% Fetal Bovine Serum (FBS) (Caisson Labs), 100 IU/ml penicillin, 100 μ g/ml streptomycin, and 0.25 μ g/ml amphotericin) for 6 days supplemented with 50 ng/ml
Techniques: Incubation, Multiplex Assay, Enzyme-linked Immunosorbent Assay, Control, Comparison, Produced
Journal: Molecular oral microbiology
Article Title: Interleukin-34 permits Porphyromonas gingivalis survival and NF- κ B p65 inhibition in macrophages
doi: 10.1111/omi.12366
Figure Lengend Snippet: Dephosphorylation of NF-κB p65 is associated with lower levels of IL-8 in IL-34-differentiated macrophages. IL-34- or CSF1-differentiated macrophages were co-incubated with P. gingivalis for 2 h Total cell lysates were assessed by western blot using phospho-NF-κB p65 (Ser-536) or total NF-κB p65 antibodies. Anti-mouse actin was used as an internal control. Data shown in Panel B are representative of three independent experiments with similar results; Panel A shows the resulting densitometry analysis of the ratio between phosphorylated and total NF-κB. Statistical analysis (one-way ANOVA with pairwise comparison) indicates a significant difference in the phosphorylated NF-κB between IL-34- and CSF1-differentiated macrophages incubated with P. gingivalis but not control or LPS-incubated macrophages.
Article Snippet: Macrophages were generated from blood monocytes in six-well culture plates in culture medium (Roswell Park Memorial Institute (RPMI)) 1640 medium [Corning] containing 10% Fetal Bovine Serum (FBS) (Caisson Labs), 100 IU/ml penicillin, 100 μ g/ml streptomycin, and 0.25 μ g/ml amphotericin) for 6 days supplemented with 50 ng/ml
Techniques: De-Phosphorylation Assay, Incubation, Western Blot, Control, Comparison
Journal: Molecular oral microbiology
Article Title: Interleukin-34 permits Porphyromonas gingivalis survival and NF- κ B p65 inhibition in macrophages
doi: 10.1111/omi.12366
Figure Lengend Snippet: IL-34-matured macrophages produce less IL-8 upon NF-kB p65-specific inhibition. Human peripheral blood monocytes were differentiated with CSF1 (50 ng/ml) and IL-34 (50 ng/ml)for 6 days in 24-well tissue culture plates (2 × 105 cells/well). The differentiated macrophages were pre-incubated with NFkB p65 inhibitor (NBP2-29321, 100, μM) and control peptide (NBP2-29334, 100 μM) overnight. Cells were then stimulated with LPS (0.1 μg/ml) for 16 h. The cell supernatants were analyzed for the production of IL-8 by ELISA. Shown is the average ± standard error, **** indicates p < 0.0001 by one-way ANOVA with Dunnett’s multiple comparison test
Article Snippet: Macrophages were generated from blood monocytes in six-well culture plates in culture medium (Roswell Park Memorial Institute (RPMI)) 1640 medium [Corning] containing 10% Fetal Bovine Serum (FBS) (Caisson Labs), 100 IU/ml penicillin, 100 μ g/ml streptomycin, and 0.25 μ g/ml amphotericin) for 6 days supplemented with 50 ng/ml
Techniques: Inhibition, Incubation, Control, Enzyme-linked Immunosorbent Assay, Comparison
Journal: Nature Communications
Article Title: Allogeneic CD33-directed CAR-NKT cells for the treatment of bone marrow-resident myeloid malignancies
doi: 10.1038/s41467-025-56270-6
Figure Lengend Snippet: a Experiment design to profile primary AML and MDS patient bone marrow (BM) samples using flow cytometry and single cell RNA sequencing (scRNA-seq). 8 AML and MDS primary samples were included for flow cytometry analyses. Data from Gene Expression Omnibus database (GSE235923) and NCBI Sequence Read Archive (PRJNA720840) were included for scRNA-seq analyses. Created in BioRender. LI, Y. (2025) https://BioRender.com/o37h997 . b Diagram showing the progression from leukemia stem cells (LSCs) to myeloblast cells (MBCs) in myeloid malignancies, along with associated biomarkers. Created in BioRender. FANG, Y. (2025) https://BioRender.com/f57l159 c – e Profiling AML and MDS blast cells using flow cytometry. c FACS detection of the subpopulations of AML blast cells, and their expression of CAR target (CD33), NKT TCR target (CD1d), and NKR ligands (i.e., CD112, MICA/B, and ULBP-1). Two representative data sets from AML samples #1 and #2 are presented. d Quantification of the proportions of the three subpopulations of AML and MDS blast cells. The combined percentage of these subpopulations totals 100%. e Quantification of the expression of CAR target, NKT TCR target, and NKR ligands on the three subpopulations of AML and MDS blast cells ( n = 7 for LSPC, and n = 8 for CMP and MBC; n represents different patient samples). f – k Profiling AML blast cells using scRNA-seq. Data from Gene Expression Omnibus database (GSE235923) were analyzed. f Combined UMAP plot showing the formation of four major cell clusters. 19 primary AML blast samples were analyzed. g UMAP plots showing the expression distribution of the CD34 , CD38 , and stem genes SOX4 and CD99 . h Bar graphs showing the cell cluster proportions of the 19 primary AML blast samples. Expression of cancer stem cell (CSC) gene signature ( i ) and NKR ligand gene signature ( j ) in the indicated cell clusters. UMAP plots showing the gene expression distributions and violin plots showing the gene expression levels are presented. Data from the 19 primary AML blast samples are shown. k Violin plots showing the expression distribution of NKR ligand gene signature in the 19 primary AML blast samples. Representative of 1 ( d – k ) and 8 ( c ) experiments. In the violin plots ( i , j ), box and whisker plots exhibit the minimum, lower quartile, median, upper quartile and maximum expression levels of each type of cell. Source data and exact p values are provided as a file.
Article Snippet: The single guide RNAs (sgRNAs) targeting the
Techniques: Flow Cytometry, RNA Sequencing Assay, Expressing, Sequencing, Whisker Assay
Journal: Nature Communications
Article Title: Allogeneic CD33-directed CAR-NKT cells for the treatment of bone marrow-resident myeloid malignancies
doi: 10.1038/s41467-025-56270-6
Figure Lengend Snippet: a Schematics showing the generation of Allo15 CAR33-NKT cells. HSPC, hematopoietic stem and progenitor cells; Lenti/iNKT-CAR33-IL-15, lentiviral vector encoding a pair of iNKT TCR α and β chains, a CD33-directed CAR, and a human soluble IL-15. Created in BioRender. LI, Y. (2025) https://BioRender.com/o37h997 . b Schematics showing the design of Lenti/iNKT-CAR33-IL-15 lentivector. ΔLTR, self-inactivating long terminal repeats; MNDU3, internal promoter derived from the MND retroviral LTR U3 region; φ, packaging sequence; RRE, rev-responsive element; cPPT, central polypurine tract; WPRE, woodchuck hepatitis virus posttranscriptional regulatory element; F2A, foot-and-mouth disease virus 2 A; P2A, porcine teschovirus-1 2A; T2A, thosea asigna virus 2A. c FACS and immunofluorescence (IF) monitoring of the generation of Allo15 CAR33-NKT cells during the 6-week culture. iNKT TCR was stained using a 6B11 monoclonal antibody. d Percentage of Allo15 CAR33-NKT cells in total live cells during the 6-week culture ( n = 4; n indicates different CB donors). e Yield of Allo15 CAR33-NKT cells ( n = 4; n indicates different CB donors). f FACS detection of surface markers on Allo15 CAR33-NKT cells. Healthy donor peripheral blood mononuclear cell (PBMC)-derived conventional CD33-directed CAR-engineered T (CAR33-T) cells were included as a control. DN double-negative, DP double-positive. g Comparison of the indicated subpopulation percentages between Allo15 CAR33-NKT and conventional CAR33-T cells (n = 5; n indicates different cell batches) h Single cell TCR sequencing analyses of Allo15 CAR33-NKT and conventional CAR33-T cells. i FACS detection of NK marker and NK receptor (NKR) expression, as well as intracellular cytokine and cytotoxic molecule production of Allo15 CAR33-NKT and conventional CAR33-T cells. j Violin plots showing the expression distribution of the indicated gene signatures in Allo15 CAR33-NKT and conventional CAR33-T cells. TF, transcription factor. k Pathway analyses of differentiated expressed genes comparing Allo15 CAR33-NKT with conventional CAR33-T cells. GO, Gene ontology ID. Representative of 1 ( h , j , k ) and >5 ( a – g , i ) experiments. For the scTCR-seq ( h ) and scRNA-seq analyses ( j , k ), one Allo15 CAR33-NKT sample (containing 12,006 cells) and one CAR33-T sample (containing 9122 cells) were analyzed. Source data and exact p values are provided as a file.
Article Snippet: The single guide RNAs (sgRNAs) targeting the
Techniques: Plasmid Preparation, Derivative Assay, Retroviral, Sequencing, Virus, Immunofluorescence, Staining, Control, Comparison, Marker, Expressing
Journal: Nature Communications
Article Title: Allogeneic CD33-directed CAR-NKT cells for the treatment of bone marrow-resident myeloid malignancies
doi: 10.1038/s41467-025-56270-6
Figure Lengend Snippet: a – e Studying the in vitro antitumor efficacy of Allo15 CAR33-NKT cells against human AML cell lines. CAR33-T cells and non-CAR33-engineered PBMC-T cells were included as therapeutic cell controls. a Experimental design. b Schematics showing the indicated human AML cell lines. THP1-FG, THP1 cell line engineered to overexpress the firefly luciferase and green fluorescence protein dual reporters (FG); KG1-FG, KG1 cell line engineered to overexpress FG; HL60-FG, HL60 cell line engineered to overexpress FG; THP1-FG CD33-/- , THP1-FG cell line further engineered to knockout the CD33 gene; THP1-FG CD1d-/- , THP1-FG cell line further engineered to knockout the CD1d gene; THP1-FG CD33/CD1d-/- , THP1-FG cell line further engineered to knockout the CD33 and CD1d genes. c FACS detection of CD33 and CD1d expressions on the indicated AML cells. d Heatmap showing the NKR ligand expressions on the indicated AML cells. The number represents the percentage of NKR ligand-positive tumor cells out of the total tumor cells. Three independent tumor cell samples were analyzed, and the average numbers are presented. e Tumor cell killing data at 24 h ( n = 4 from four different cell product donors). f , g Studying the tumor cell killing mechanisms of Allo15 CAR33-NKT cells mediated by NKRs (i.e., NKG2D and DNAM-1). f Experimental design. g Tumor cell killing data at 24 h (E:T ratio = 10:1; n = 4 from four different cell product donors). h Diagram showing the CAR/TCR/NKR triple tumor-targeting mechanisms of Allo15 CAR33-NKT cells, and the CAR single tumor-targeting mechanism of CAR33-T cells. GrzB, Granzyme B. Created in BioRender. FANG, Y. (2025) https://BioRender.com/j50y057 . i , j Studying the expression of effector molecules of Allo15 CAR33-NKT cells. i FACS detection of surface CD69 as well as intracellular Perforin and Granzyme B in Allo15 CAR33-NKT cells. j Quantification of ( i ) ( n = 3 from three different cell product donors). Representative of 3 experiments. Data are presented as the mean ± SEM. ns not significant, * p < 0.05; ** p < 0.01; *** p < 0.001; **** p < 0.0001, by one-way ANOVA ( g , j ), or two-way ANOVA ( e ). Source data and exact p values are provided as a file.
Article Snippet: The single guide RNAs (sgRNAs) targeting the
Techniques: In Vitro, Luciferase, Fluorescence, Knock-Out, Expressing
Journal: Nature Communications
Article Title: Allogeneic CD33-directed CAR-NKT cells for the treatment of bone marrow-resident myeloid malignancies
doi: 10.1038/s41467-025-56270-6
Figure Lengend Snippet: a – g Studying the in vivo antitumor efficacy of Allo15 CAR33-NKT cells in a THP1-FG human AML xenograft NSG mouse model. a Experimental design. b BLI images. c Quantification of ( b ) ( n = 5). d Kaplan–Meier survival curves ( n = 5). e BLI images showing the presence of residual tumor cells in mouse tissues at the termination day. GI tract, gastrointestinal tract. FACS analyses of surface CD33 ( f ) and intranuclear cancer stem cell (CSC) marker ( g ) expression in THP1-FG tumor cells, collected from mouse bone marrow at the termination day ( n = 5). h – n Studying the in vivo antitumor efficacy of Allo15 CAR33-NKT cells in a KG1-FG human AML xenograft NSG mouse model. h Experimental design. i BLI images. j Quantification of ( i ) ( n = 5). k Kaplan–Meier survival curves ( n = 5). l BLI images showing the presence of residual tumor cells in mouse tissues at the termination day. FACS analyses of surface CD33 ( m ) and intranuclear CSC marker ( n ) expression in KG1-FG tumor cells collected from mouse bone marrow at the termination day ( n = 5). o – r Studying the antitumor efficacy of Allo15 CAR33-NKT cells against primary patient samples. o Experimental design. Created in BioRender. LI, Y. (2025) https://BioRender.com/o37h997 p Blast cell killing data at 24 h ( n = 4 from four different therapeutic cell donors). Data from three AML and one MDS patient samples are presented. FACS analyses of surface CD33 ( q ) and intranuclear CSC marker r expression in the remaining blast cells collected after the 24-h in vitro tumor cell killing assay ( n = 4 from four different therapeutic cell donors). s Diagram illustrating the ability of Allo15 CAR33-NKT cells to target CD33-low/negative LSPCs in myeloid malignancies. Created in BioRender. LI, Y. (2025) https://BioRender.com/m06k581 . Representative of 2 ( a – n ) and 3 ( o – r ) experiments. Data are presented as the mean ± SEM. ns, not significant; * p < 0.05; ** p < 0.01; *** p < 0.001; **** p < 0.0001, by two-tailed Student’s t test ( f , g , m , n ), one-way ANOVA ( c , j , p , q ), or log rank (Mantel-Cox) text adjusted for multiple comparisons ( d , k ). Source data and exact p values are provided as a file.
Article Snippet: The single guide RNAs (sgRNAs) targeting the
Techniques: In Vivo, Marker, Expressing, In Vitro, Two Tailed Test
Journal: Nature Communications
Article Title: Allogeneic CD33-directed CAR-NKT cells for the treatment of bone marrow-resident myeloid malignancies
doi: 10.1038/s41467-025-56270-6
Figure Lengend Snippet: a Experimental design. Created in BioRender. LI, Y. (2025) https://BioRender.com/o37h997 . b FACS detection of AML blast cells (gated as CD33 + CD45 + cells) in various tissues collected from experimental mice at the termination day. c FACS analyses showing the AML blast cell loads in various tissues of experimental mice ( n = 3 for Vehicle and Allo15 CAR33-NKT; n = 4 for CAR33-T). Tissues from both the Vehicle and CAR33-T cell groups were collected from experimental mice at the termination day. Tissues from the Allo15 CAR33-NKT cell group were collected from experimental mice at day 100. d H&E-stained tissue sections. Tissues were collected from experimental mice at day 20 post therapeutic cell injection. Scale bars, 100 µm for bone marrow samples, 200 µm for liver and kidney samples. Three independent tissue samples from each group were analyzed, and one representative data are presented. e Kaplan–Meier survival curves of experimental mice over time ( n = 3 for Vehicle and Allo15 CAR33-NKT; n = 4 for CAR33-T). Representative of 2 experiments. Data are presented as the mean ± SEM. ns not significant, * p < 0.05; ** p < 0.01; *** p < 0.001; **** p < 0.0001, by one-way ANOVA ( c ), or log rank (Mantel-Cox) text adjusted for multiple comparisons ( e ). Source data and exact p values are provided as a file.
Article Snippet: The single guide RNAs (sgRNAs) targeting the
Techniques: Staining, Injection
Journal: Nature Communications
Article Title: Allogeneic CD33-directed CAR-NKT cells for the treatment of bone marrow-resident myeloid malignancies
doi: 10.1038/s41467-025-56270-6
Figure Lengend Snippet: a – f Studying the synergistic effect of Allo15 CAR33-NKT cells with HMA Decitabine using an in vitro tumor cell killing assay. a Experiment design. THP1-D, THP1 tumor cells treated with decitabine. b FACS detection of CAR target (CD33), iNKT TCR target (CD1d), and NKR targets (i.e., CD112, MICA/B, ULBP-1, and ULBP-2/5/6) on the indicated AML cells. c Quantification of ( b ) ( n = 4 from four different experimental batches). d Tumor cell killing data at 24 h ( n = 4 from four different experimental batches). e FACS detection of intracellular Granzyme B production by Allo15 CAR33-NKT cells. f Quantification of ( e ) ( n = 4 from four different experimental batches). g Diagram showing the upregulation of CD1d and NK ligands on AML tumor cells following treatment with HMA. Created in BioRender. FANG, Y. (2025) https://BioRender.com/n85n160 . h – k Studying the in vivo synergistic effect of Allo15 CAR33-NKT cells with HMA Decitabine using a THP1-FG human AML xenograft NSG mouse model. h Experimental design. i BLI images showing the presence of tumor cells in experimental mice over time. j Quantification of ( i ) ( n = 5). k Kaplan–Meier survival curves of experimental mice over time ( n = 5). Representative of 2 ( h – k ) and 3 ( a – g ) experiments. Data are presented as the mean ± SEM. ns not significant, * p < 0.05; ** p < 0.01; *** p < 0.001; **** p < 0.0001, by two-tailed Student’s t test ( c ), one-way ANOVA ( d , f , j ), or log rank (Mantel-Cox) text adjusted for multiple comparisons ( k ). Source data and exact p values are provided as a a file.
Article Snippet: The single guide RNAs (sgRNAs) targeting the
Techniques: In Vitro, In Vivo, Two Tailed Test
Journal: Nature Communications
Article Title: Allogeneic CD33-directed CAR-NKT cells for the treatment of bone marrow-resident myeloid malignancies
doi: 10.1038/s41467-025-56270-6
Figure Lengend Snippet: a – e Studying the HSPC targeting using an in vitro immune cell killing assay. a Experimental design. G-CSF, granulocyte colony-stimulating factor. Created in BioRender. LI, Y. (2025) https://BioRender.com/o37h997 b FACS detection of CD33 expression on the indicated immune cells. c Immune cell killing data at 24 h ( n = 3 for healthy donor 1, and n = 5 for healthy donors 2 and 3; n indicates different therapeutic cell batches). d Flow detection of CD1d expression on HSPCs. e HSPC killing data at 24 h ( n = 3; n indicates different therapeutic cell batches). f – h Studying the hematopoietic precursor targeting using an in vitro HSPC colony formation assay. f Experimental design. g Images showing the formation of Burst-Forming Unit-Erythroid (BFU-E) and Colony-Forming Unit-Granulocyte/Macrophage (CFU-GM) colonies. h Quantification of ( g ) ( n = 8). i – p Studying the hematopoietic precursor targeting using an in vivo bone marrow-liver-thymus (BLT) humanized mouse model. i Experimental design. Created in BioRender. FANG, Y. (2025) https://BioRender.com/g87v886 j FACS detection of human immune cells in the bone marrow collected from BLT mice 8 weeks post HSPC injection and prior to therapeutic cell injection. My, myeloid cell; DC, dendritic cell. k FACS detection of CD33 expression on the indicated immune cells. For ( j , k ) data from three independent mice were analyzed, and one representative data are presented. l Body weight measured over time. m Clinical scores recorded over time. The score was calculated as the sum of individual scores of 5 categories (activity, posture, dehydration, diarrhea, and dishevelment; score 0–1 for each category). n FACS analyses of immune cell targeting in bone marrow on Day 15. The percentage of the indicated immune cells among total CD45 + CAR - immune cells from each experimental mouse was recorded, and the fold change was calculated by normalizing to the NT group. FACS analyses of CD33 + and CD33 - cell targeting in bone marrow ( o ), and immune cell targeting in spleen and liver ( p ). NA not available. In ( l – p ), n = 3 for NT and CAR33-T, and n = 4 for Allo15 CAR33-NKT; n indicates different experimental mice. Representative of 2 ( i – p ) and 3 ( a – h ) experiments. Data are presented as the mean ± SEM. ns not significant, * p < 0.05; ** p < 0.01; *** p < 0.001; **** p < 0.0001, by one-way ANOVA ( h , n , o , p ). Source data and exact p values are provided as a file.
Article Snippet: The single guide RNAs (sgRNAs) targeting the
Techniques: In Vitro, Expressing, Colony Assay, In Vivo, Injection, Activity Assay
Journal: Nature Communications
Article Title: Allogeneic CD33-directed CAR-NKT cells for the treatment of bone marrow-resident myeloid malignancies
doi: 10.1038/s41467-025-56270-6
Figure Lengend Snippet: a , b Studying the graft-versus-host (GvH) response of Allo15 CAR33-NKT cells using an in vitro mixed lymphocyte reaction (MLR) assay. CD33-negative PBMCs were pre-sorted using MACS or FACS and used as stimulator cells. Conventional CAR33-T cells were included as responder controls. a Experimental design. b ELISA analyses of IFN-γ production on day 4. N, no addition of stimulator cells ( n = 4). c – h Studying the GvHD risk of Allo15 CAR33-NKT cells using a human xenograft NSG mouse model. c Experimental design. d Clinical GvHD score recorded over time ( n = 5). The score was calculated as the sum of individual scores of 6 categories (body weight, activity, posture, skin thickening, diarrhea, and dishevelment; score 0–2 for each category). p was calculated using Day 50 data. e Body weight measured over time ( n = 5). p was calculated using Day 50 data. f Kaplan–Meier survival curves ( n = 5). g H&E-stained tissue sections. Tissues were collected from experimental mice on day 50. Scale bar, 100 µm. h Quantification of ( g ) ( n = 5). i – l Studying the CRS response induced by Allo15 CAR33-NKT cells using a THP1-FG human AML xenograft NSG mouse model. i Experimental design. j Body weight of experimental mice over time ( n = 4). ELISA analyses of mouse IL-6 and SAA3 in mouse serum ( k ) or peritoneal fluid ( l ) ( n = 4). NT, samples collected from tumor-bearing mice receiving no therapeutic cell treatment. m Studying the long-term safety of Allo15 CAR33-NKT cells using a human xenograft NSG mouse model. Tissues from experimental mice were collected 120 days after injection with Allo15 CAR33-NKT cells. Data were presented as pathologist’s scores of individual mouse tissues ( n = 5). Representative of 1 ( k ) and 3 ( a – j ) experiments. Data are presented as the mean ± SEM. ns not significant, * p < 0.05; ** p < 0.01; *** p < 0.001; **** p < 0.0001, by Student’s t test ( d , e , h ), one-way ANOVA ( b , k , l ), or log rank (Mantel-Cox) text adjusted for multiple comparisons ( f ). Source data and exact p values are provided as a file.
Article Snippet: The single guide RNAs (sgRNAs) targeting the
Techniques: In Vitro, Mlr Assay, Enzyme-linked Immunosorbent Assay, Activity Assay, Staining, Injection
Journal: Heliyon
Article Title: Genetic modifications of EGLN1 reactivate HbF production in β 0 -thalassemia/HbE
doi: 10.1016/j.heliyon.2024.e38020
Figure Lengend Snippet: Targeted sequencing reveals three PHD2 variants in 57 β 0 -thalassemia/HbE patients. Schematic diagram representing the human EGLN1 gene (58,532 bp; NC_000001.11: 231,363,756–231,422,287) and PHD2 protein (426 aâ; UniProtKB: Q9GZT9). MYND, MYND zinc finger domain; Catalytic domain, ferrous iron and 2-oxoglutarate (2OG)-dependent HIF prolyl hydroxylase domain. Arrow lines indicate variants identified in this study.
Article Snippet: Chemically modified single guide RNAs (sgRNAs) targeting
Techniques: Sequencing
Journal: Heliyon
Article Title: Genetic modifications of EGLN1 reactivate HbF production in β 0 -thalassemia/HbE
doi: 10.1016/j.heliyon.2024.e38020
Figure Lengend Snippet: EGLN1-specific gRNA mediated PHD2 knockdown. (A) Editing efficiency of sgRNAs used in this study. (B) Quantitative real-time PCR demonstrating the relative EGLN1 mRNA expression normalized to the GAPDH mRNA expression at day 14 of culture. (C) Representative western blot analysis showing the expression of PHD2, BCL11A, GATA1 and GAPDH at day 14 of culture. Data are presented as mean ± SD. ∗, P < 0.05; ∗∗, P < 0.005; ∗∗∗∗, P < 0.0001.
Article Snippet: Chemically modified single guide RNAs (sgRNAs) targeting
Techniques: Knockdown, Real-time Polymerase Chain Reaction, Expressing, Western Blot